Some news about my worm research Sep 23, 2015, 7:57p - Science
I recently published my second first-author paper, rounding out the work of my time in grad school. MIT News wrote about it, and I was also interviewed by Lab Equipment about the research. Enjoy! more »
No comments - Write 1st Comment
Medicine as Evolutionary Expansion Jan 23, 2014, 12:46p - Science
We've all heard about "survival of the fittest." This saying explains why certain species thrive and others go extinct, and it captures the core of Darwin's idea of evolution by natural selection. People also use it colloquially to explain why certain individuals are successful and rich and others are weak and poor - some people are more "fit" than others. ... more »
Read comments (3) - Comment
Christoph
- Feb 7, 2014, 7:33a
Hey!
I really enjoyed your post. It's a thought process I've been going over a few times and have been trying to tie together; but didn't quite finish. I like your full circle approach. I also conceptually agree with the notion of "evolutionary space" as a property of a population or society that is to be expanded. You can even popularize the concept by calling it specialization and pulling in the economic theory related to that? That would be saying that more diversity, genetically, can potentially lead to more diversity at the phenotypic level, which allows more specific ability -- as one boundary phenomenon.
On the exact point of how medicine comes into this, I think you have touched on something very technical, but profoundly important for the role of science (and medicine / "health" ) in the future of society -- my thought for a long time has been along those lines as well, which is a controversial way of phrasing this thought because it's binary for most people: affected by disease makes it a huge emotional experience, not affected leads largely to denial of personal connection - in my experience - so putting the idea of medicine and associated scientific inquiry into the context of the larger fitness picture of a population is a fabulous full-circle.
In short, thank you for this post!
nikhil
- Feb 7, 2014, 7:34a
Cool, glad you read it and liked it. I've been thinking about it for maybe a year and finally wanted to write it down, so I could move on. My next post will be about food!
One thing I'm not convinced about is whether more combinations makes for a fitter population. One could argue that keeping "weak" genes in the mix (1) seems bad because they persist, and (2) allows their weakness to be exposed in the future, e.g. more likely to lead to a dead end, i.e. you're just delaying the inevitable. I think those arguments are weakened if there is a lot of pleiotropy, esp. tissue-specific pleiotropy. And not just any pleiotropy - pleiotropy where the same gene has a negative effect in one tissue (e.g. heart) but meanwhile has a positive effect in another tissues (e.g. brain). For example, maybe a specific allele of a fat-storing enzyme causes heart disease in the heart, but in the brain it provides nutrients that enable dramatic growth and increased intelligence. So solving heart disease would keep such people around, benefiting the population as a whole. If one could find some examples like this, I would be pretty much convinced that greater combinations might be a net win.
nikhil
- Feb 25, 2014, 7:16p
Dengke pointed out today that there is a related area of research called "evolvability", or the capacity for an organism to evolve.
The Wikipedia page is one place to start, thought I didn't find it very clear: http://en.wikipedia.org/wiki/Evolvability
This review paper has some good points: http://www.nature.com/nrg/journal/v9/n1/abs/nrg2278.html
"Representation" in neuroscience Aug 5, 2013, 12:19p - Science
The word "representation" is used pervasively in neuroscience. Here's an example: "The neural activity in visual cortex represents the visual input received by the eyes." I've found this word troubling since the very day I started grad school, and I had hoped that my troubles would abate as I learned more in the last 6 years. Alas, they have not, ... more »
Read comments (4) - Comment
Clayton Aldern
- Aug 5, 2013, 9:29a
I don't know. I think, especially when discussing computational models, 'representation' is particularly useful. Say that someone was coming up with a theory for how the visual system works, and had drawn up a computational model that has images being encoded simply by the greyscale value at each pixel. Here, the pixel representation is the wrong representation, because any slight perturbation of the image will drastically shift the response vector in high dimensional space. You need a model that is invariant to size/rotation/translation, because that's how we know our visual system works on a behavioral level. The next model would seek to account for this, and neurobiological experiments could later be performed to validate the model.
To me, 'representation' has little to do with function and everything to do theory—that is, what types of operations we might expect the cells/systems of interest to perform. How we imagine such stimuli being 'represented' in the brain. Thinking in terms of the representation problem allows for good, hypothesis-driven work towards confirming/rejecting these models.
Glen
- Sep 21, 2013, 1:04a
Bravo - err, you do know that Skinnerians have been saying similar things for 60 years, right?
Yin Xin
- Sep 14, 2015, 7:47a
I just started my neuroscience career, and I felt confused when I met the word "representation". Why don't these neuroscientists use another word?
Eric
- Apr 20, 2017, 10:16a
Maps represent the world, right? Representations are just the internal maps by means of which we steer (this is from Dretske). There is no implied dualism.
It seems innocuous enough, there is no dualism implied, any more than when I use a map to get around town.
It is a representation, not the world itself, upon which your behaviors are based. E.g., the representation of the world in V1 is what you base your decision to take your foot off the brake pedal, for isntance. You don't have magical direct access to the stop sign. It is indirect, mediated by sensory channels.
OTOH, if you don't like the word, you could use another word. Visual information, visual signals, etc.. They are pretty much all used synonymously, and people aren't too worried about words as much as the biological mechanisms and explanatory purchase offered by the discovered mechanisms.
When systems are really simple the language of representation is not used much, because organisms more directly coupled to the environment (e.g., venus fly traps are never discussed in such terms). But when layers of information processors are interleaved between stimulus and behavior (e.g., most vertebrates, and many vertebrates), it is more likely to be used because it is natural and useful and innocuous.
I'm not so sure we should be going back to Skinner, Glen. Just sayin'. :)
Lab pics on MIT CAST Jul 29, 2013, 3:35p - Science
The MIT Center for Art, Science and Technology (CAST) is doing a series on the similarity between lab workspaces and artist studios. They put up some photos of my lab workspace, so if you're interested, check it out. more »
No comments - Write 1st Comment
Gap-free neural circuits Dec 8, 2012, 11:38a - Science
As I mentioned in a previous post, Tots and I are teaching a class on neural circuits this January during IAP at MIT. IAP is a time where anyone can teach anything they want - I think it's a cool testing ground for classes, and we didn't have anything like it that I remember at Stanford. I'm excited about ... more »
Read comments (1) - Comment
neha
- Dec 8, 2012, 11:38a
this is awesome nikhil. i might stop by the first class!
Neural circuits Nov 21, 2012, 11:33a - Science
Neuroscience, the study of the brain, is absolutely fascinating. But why choose neuroscience over any other pursuit? We can try to understand an infinite set of things in our world, from the economic effects of rape to the forces that keep atoms together. But only biology takes a stab at trying to understand the very first thing, *us*. Without us ... more »
No comments - Write 1st Comment
Making DNA look simple (again) Apr 10, 2012, 6:30p - Science
I recently got sick of doing science. After observing my own productivity and passion for science ebb and flow over the past few years, I've found that I live a roughly 6-month cycle: 6 months of scientific experiments, 6 months of something else (usually programming, often blogging, sometimes installing hardware floors and doing experiments on myself). It seems that when ... more »
Read comments (56) - Comment
Tron
- Jul 25, 2009, 10:27p
Thank you very much for making this available.
belle
- Aug 5, 2009, 7:16a
this is the best thing since sliced bread!! thank you just saved me thousands of hrs
dude,
- Nov 3, 2009, 6:33p
awesome.
jasonII
- Nov 12, 2009, 8:59a
Thanks, this works great. A few things though. Some of us work on large (18kb) genes. Is there any way to change the scale bar? Also, being able to indicate alternative spice events would be nice.
nikhil
- Nov 18, 2009, 9:29p
Thanks for the request jasonll. I've updated the graphic maker so you can now change the size of the scale bar, to be something more appropriate for your 18kb genes. Not sure what the convention is for indicating alternative splice sites - why not just make 2 separate gene models? I guess if there are several it would be nice to consolidate them into one image. If you have any ideas about what this would look like, lemme know.
nikhil
- Nov 19, 2009, 11:54p
Alan Marnett over at Benchfly.com asked me to write a blog post for them about the Exon-Intron Graphic Maker. It's just like this post, slightly revised. Storing the link here for safekeeping.
http://www.benchfly.com/blog/making-dna-look-simple/
omar
- Nov 29, 2009, 11:07p
dude this has advanced my research significantly
jasonII
- Feb 21, 2010, 8:40a
thanks for the scale bar modification. about the alternative splicing, i suppose it would be helpful if you could color them in. this would also be helpful to mark out certain functional domains easily. three or four colors would be wonderful and spice things up a bit!
siavash
- Apr 4, 2010, 6:10p
hi nikhil,
i also wanted to thank you for making this available. saved me so much time. also wanted to second jasonII's comment about other colors, for marking protein domains, etc.
but its wonderful, thanks a million.
Nick
- Nov 15, 2010, 7:09a
Thank you very much for this. I am an undergraduate doing a genetics research project and this has given me the ability to graphically show exon and intron positions the way I wanted to!
Pascal
- Feb 27, 2012, 7:34a
Great tool. What you also might want to consider is that UTRs can be across more than one exon. I think with the current options it is not possible to do that.
nikhil
- Mar 10, 2012, 7:36a
Pascal, actually I think you can do what you want.
Just like with the protein-coding field, separate exons and introns in the UTR fields with commas, and you'll be all set. That way you can display a single UTR containing multiple exons and introns.
jsto
- May 18, 2012, 1:24a
Thanks a mil nikhil
I wonder if its possible to extend the image to show up and downstream regions?
Pakpour
- May 31, 2012, 12:40p
Thank you thank you thank you so much for sharing this program. You have saved me huge amounts of time and it is such an easy and intuitive program to use!
BMD
- Dec 27, 2012, 12:29a
Hi Nikhil,
Thank you for this awesome tool! I used it to make a figure for my PhD thesis. I couldn't find any other tool that would draw high-res gene structures for me. At first, I was skeptical, because your tool required manual input of the sequences and boundaries, when this information is already available for my genes in GenBank. Also I was worried that the spaces and numbers that were contained in the sequences I pasted would mess things up. But it worked fine and only took a few minutes to copy-paste the sequences and put the commas. The genes I'm working with are monster genes with tons of exons each, and some very long introns, so I'm glad it worked so well. The only thing I would have liked is to have an option to have the exons numbered.
Jason
- Nov 2, 2013, 11:03a
That is art!
Steve
- Oct 15, 2014, 6:53p
very cool! i'm using it to make group meeting slides, and am finding that the text is coming out a bit small. any way you could add a feature to let you change the font size?
nikhil
- Oct 20, 2014, 8:10p
Hi Steve,
To make changes to the text or anything else in the graphic, download the PDF and open it in your favorite graphics program. I use the open source alternative to Adobe Illustator called Inkscape. There you can make any changes to your heart's delight.
Kuldeep
- Jan 14, 2015, 7:44a
How to add the size of exons (bp) or introns (bp) in the map? For comparison of same gene of different organism, is it possible to go in single run?
Although it is very helpful I would like you thanks a lot.
nikhil
- Jan 14, 2015, 8:02a
Hi Kuldeep,
There is currently no way to automatically annotate each exon or intron with its length in base pairs. I have never seen this kind of annotation before. Can you point me to an example of what this would look like?
Also, there is no easy way to compare multiple genes (e.g. across organisms, across isoforms) at the same time, yet. This feature has been requested several times so I may add it in the future.
Lisa
- Jan 15, 2015, 7:14p
For some reason, the scale bar isn't changing for me whatever number I put from (1-1000bp). Is there anyone else facing similar problem or is it me only??
nikhil
- Jan 15, 2015, 9:25p
Hi Lisa,
What browser, browser version, and OS are you using? Are you referring to the graphic made in the web browser, or the downloadable PDF? I just tested the graphic generated in the web browser on Firefox, Chrome and Internet Explorer on Windows 7 and the scale bar resizes just fine. How many bases have you entered? You have to enter some bases before the scale bar will be displayed.
Lisa
- Jan 18, 2015, 1:51a
Hi Nikhil,
Thanks for your reply. I misinterpreted the use of the scale bar. Is there any means to increase the width of the exons ? (and the introns could probably be joined by dots which are not to scale) I am working on human genes and there are a good number of mutations to show in a single exon itself. The width of the exons doesn't permit me to be able to show all the mutations.
Thanks again
nikhil
- Jan 18, 2015, 8:43a
Hi Lisa,
There is no method for increasing the width of the exons. The main function of this app is to quickly make exon-intron graphics that are to scale. I'll keep your issue in mind, but for now I suggest using the Exon-Intron Graphic Maker to make the gene model to scale, and then downloading the PDF to alter the scale in a free app like Inkscape. You could also mark all the mutations in the Graphic Maker, even if they overlap and are too dense, and then spread them out in the PDF so that relative position within the exon remains to scale.
YZ
- Nov 10, 2016, 6:19p
I really enjoy the program. Please excuse my otherwise probably simplistic question. When creating a gene diagram, there are some exons that could be small at only few dozen bps. Some introns, on the other hand, could be thousands of bp. If done this way, when looking at the final graphic the exons are tiny because they are drawn to scale in proportion to the intron size. Is there a good way to account for that or would you suggest a different way to graphic it? thanks!
nikhil
- Jan 25, 2017, 10:42a
YZ, I would suggest a different approach in your case. Seems like you want a graphic that has different scales for the exons vs. the introns. My webapp doesn't support that right now, I'm afraid. I'm not aware of any way to do that except by hand in a graphics program.
Ankita Gurao
- Aug 21, 2017, 12:04a
The tool is very elegant and handy.Brilliant solution for presenting gene structures in publications. I have a suggestion for you, add a 'How to cite?' section.
Claud
- Sep 28, 2017, 6:50a
Thank you for the program. It have been very useful for me.
Could it be possible to add a section upstream and a section downstream of the beginning and end of transcription (respectively)? It would be very useful to add markers in those sections. Thanks!
nikhil
- Oct 5, 2017, 10:41a
Hi Claud,
Yeah, there isn't any easy way to depict non-transcribed regions using this web app. I'll consider adding something like this in the future. Glad you find this useful.
nikhil
- Oct 5, 2017, 10:43a
Ankita,
If you want to cite this web-app, you can use the following citation:
Bhatla, Nikhil. 2012. Exon-Intron Graphic Maker. Available at http://wormweb.org/exonintron
Claudia
- Aug 28, 2018, 6:31a
Good morning, first of all thank you for the useful program.
Is there any chance to change the color of the black bar representing the DNA sequence and to reduce it a little bit (or to increase the written label's size)?
I know it is a futile quesiton but it will improve the appeal of my immage.
Thank you very much.
Sean
- Mar 26, 2019, 12:36p
Here it is, 2019 and 10 years after you made this, and I only just discovered this tool. I just wanted to say thanks for sharing, it is very much appreciated!
Guangzhao Qi
- Oct 13, 2019, 2:26a
Thanks a lot!
nikhil
- Feb 4, 2020, 9:39a
Claudia,
For color and size changes, the best thing to do is to open the PDF in a illustration program, such as the free Inkscape. There you will be able to edit everything to your heart's delight.
Abdellah Barakate
- Feb 12, 2020, 3:10a
I love this Exon-Intron Graphic Maker but I am stuck with an issue. I have genes with introns in the 5'UTR and/or 3'UTR. Does anybody know how to add these introns?
Many thanks.
Abdellah Barakate
- Feb 12, 2020, 3:22a
Sorry guys, I just realised that I can add introns to UTR by simple using upper and lower cases as in the CDS.
Cheers
Sara
- Apr 9, 2020, 4:51p
Thank you very much for the nice tool!
Basharat
- Aug 13, 2020, 10:25a
Hi,
Can we use it for mapping point mutations in exon of mammles
nikhil
- Aug 27, 2020, 9:20a
Hi Basharat,
Yes, this program works with a genetic sequence from any organism.
Liina
- Oct 27, 2020, 8:16p
Thanks for this useful tool! I managed to retrieve PDFs for all of my genes, except TTN, which gave me an error 'The requested URL's length exceeds the capacity limit for this server' (PNG downloads ok). I blame the size of the gene (281 kb). Is there a workaround to retrieve the PDF that I could work with in the Illustrator?
Hart
- Dec 21, 2020, 6:15p
Useful tool!
Thank you very much
Vanessa
- Feb 21, 2021, 7:38a
Thank you so much for this useful tool! Is there any way to present genes in the negative strand? i.e. so that the pointer points to the left instead of pointing to the right.
David
- Mar 17, 2021, 7:59a
Fantastic tool! Thank-you for making this :)
SKT
- Jun 2, 2021, 4:27p
Hi, Is it possible to avoid having to manually enter the gene sequence? I have a long 20Kb gene.
GyuHwang
- Nov 23, 2021, 12:03a
Thank you. It's very useful tool.
When I just know intron length, so I use a exel function [=rept("a",intron length)] result. It is working well. :)
Erik Huckvale
- Mar 1, 2022, 12:33p
What tool do you use under the hood for the visualizations? Is it an R package or something with javascript?
Robert Mukiibi
- Oct 9, 2022, 7:34a
How about making it possible to color introns and exons different colors than just black.
Tamir P
- May 29, 2023, 5:16a
what a grate tool!
but- having problem with exporting as HQ PDF (500 Internal Server Error)
Linx
- Jun 15, 2023, 8:09a
Why cannot download the PDF from this website anymore?
Yanyan
- Jun 29, 2023, 7:20a
hihi,thank you so much for coming up with such a simple handy tool.It is a big big help, but unfortunately ?I can't download the PDF,I don't know if you could receive my message, if so, that would be great!
T
- Aug 4, 2023, 12:42p
Thank you so much for making this tool! I've been using (and citing) it for years. However, I just went to use it today and received an "Internal Server Error" message after clicking the "Download High-Quality PDF" button. Could you please help?
nikhil
- Dec 10, 2023, 12:04a
PDF download error should be fixed now. Sorry for the trouble!
Ish
- Aug 7, 2025, 10:46a
Is there any way to get gene and allele names in Italics?
Thank you.
HYY
- Sep 19, 2025, 2:43a
Thank you very much! It helps me a lot!
Anonymous
- Jul 16, 2026, 1:39a
GACTTGCCTTACCATTAAAAAGCAAGGGGAGCACAAGCATTATTACACAAAGCAAAAGCACTAGCCATGGCAGCGTCGCGCTACGAGGTGGAGGTGACGGTGGCCTCGGCGCGCGACCTCAAGAACGTCAACTGGCGCAACGGCGACCTCAAGCCCTACGCCGTCGTGTGGATCGACGACGGCGCCAAGTGCTCCACCCGCGTCGACCTCGACAACGCCGACAACCCCACCTGGGATGACAAGCTCACCGTCCCTCTCCCGCCCTCCACCCGCCTCGACGACGCCGTCCTCTACCTCGACGTCGTCCACGCCAACGCCACCGACGGCGTCAAGCCCCTCGTCGGCTCCGCGCGCCTCCCGCTCCGCGACGTCCTCGCCGACACCGGCATAGGCGCCCGAGCCTCCCGCTCCCTCCGCCTCAAGCGCCCCTCCGGCCGCCCCCATGGACGCCTCGAAGTCCGCGTCGCCGTCCGCGAGCCCAAGCGCTACTACGACCCCTCGCCGGCGTACCCTGCTCCCTACCACCAGCAGTCGTCCCGTGACCCCTACGCCTACGGTAACACTACAACTGGTGGCTATGGCTATGCCTATGGCGGGGCCCCTCCGGCTCCGTACTCCGCGGCCCCTCCTGCTGGATACCCGTCGGCCTATGGAGGAGCGGCTCCTACTCAACCTGCCTATGGCTCCGCCGCGCCACCTCAACCTGCCGCTGTCAGCTATGGAGCGCCTCCTGTGGATGCAAAGAAGAAGAGCAAGATGGGCATGGGGGGTGGGCTGGCGGTTGGCGCGGCGGCCGGCGTTCTTGGCGGTCTGGCGCTGGCGGGCGGCGCCAGCTACCTGGAGAACAAGTTTGAGGATCGCGTGGCGGAGCGGGTGGAGGAGGACCGCTACGGCGGCGGCGGTGGTGGCTACGACGACTACGGCGATGACGACTATTAATAATTTATATGATATTCGAATTGCACTTGCAGGGGAGTCAGATTATTGTAATTGAGTCTTGTGTTTTTATCATCCTTGTCTTACAAATCAATATCAAATTAAATTAAAACTCGTGTGTGTGTGTGTGTGTGATCCTAGCTAGCTGGGAGTATATCTCGATCCGTAGAGTTCCGGCGTCGACGGTGGCAGCGCCCACTGGTTGGCGTCGATGTAGGAGACGTCCATGAAGGGCGCGGCCTGGCGCTGGTCAAGCTGCCGCGCGTAGGACACCCTGCCGGTGGCGGCGGTGGCGGATCCGGGGCCCCAGCACGCGTACTCCGCGAACCACACCTGCTGCCGCCTGCCGGGGTCGCCCCAGTCGTTCCACCCCTCCGCCGCCACCACGTCGCCGAGGTACGTCTCCGCGAACACCACCGTCGCGTACGGCCCCCACGCCCTCCCCAGCCACACCTGCCCCGTCCCCACCACGCTGCACCGCACGAACGCGAACCCCGTCCTCTC
full-length
- Aug 2, 2026, 6:16a
ATGGCAGCAAAGTTGGGTTCTTTCAAGTACAATTTCCAAGAGAAAAGAGAGAGGTTGCTCTCAACCCAGAAGGACTACTCCGAGCTGGGCTTCGTCCACATCGAGGAACAAGAGCCATATGGGTCTCCTCGCTGCTGCACTTTTCGATCAGTTTCCGATAGAATTATGAGCTGGTGCCGGACTGTACAAAATGTTTCTAACCGGGCAATTCGGATGGGTCAATCCGATCCGAGAAAGATCGTATTCGCGGCCAAGATGGGTCTGGCCTTGATGATCATTTCGTTGCTGATTTTCCTCAAAGAGCCTTTCAAGCAGCTCAGTCGTTACTCGGTCTGGGCCATCCTCACTGTTGTGGTAGTATTTGAGTTTAGCATAGGTAAATGTATTTTTCTACCATTCATTTTGATTTTGGCTTTATTTAGTCATTTCATCATCTGGGTGTTCATCGATTTGCACGTGTGCCTATGCTTTTGGGCGTCTCTGGGTAGAAATAGTTGTTTCTTGTTTTGTTGCATTTTACTTTTTTTTTTTTGGGGGGCAAAATTGAGGGTCTTTTTTTTTAGATTTAATTTTTTGTTTGTTACTATTGTTAGCATTAGTAGTTCACATGAAAAGAAACCAACTTTCACGTTCAGTATGTTATAAAGTGGAACGCTTGACAGTGTAATCACCTGAAGGGAATTGGAAAAAGCATGGAGCTCATGATTACAATAATGAAGTGAAACTAAAGTGTTTTTGTTTATTCACGATAAGCTATTATTGTACAAGAATGAATATTTTGGTGAACAGCTTCCCTCAATCATCCGACATCTTTTTGTTTTTTCAAATTGTTTTAAATTAACTAAATCCATCTTCTTTCTTTTGTTTTAATAGGCTGGGCCTTCAACTTGAATTAGTTCGTAGTTCAAAGTGCAATTTTTTTTTTGCAGTGTAGTCTGTTGTCTTCCAACATGAGCATGCCTATGTCTGTTTTACTTTCTTATATTCAGTGGCTATGTTCTTCTGCAGGAGCGACTCTGAGCAAAGGATTTAACCGTGGGTTAGGGACATTTTCTGCTGGAGGCCTTGCTTTGGGTATGGCGCACTTATGTGGACTAGCTGGAGAGTGGGAAGAAGCTGTTATTTTCGCTAGTATCTTTATCATAGGTCTGAATTTGCAATCAATATACTTTTTTTTATGGCATGTCACTGGAAAGCTCAATGTATGCTAATTGCTAATTGCTAATTTTGTGTTTTGTTTAGTTTTTATTTTCATGACGTGTTATTTGGTCGCTAGGATTTCTTGCAACTTATGCAAAGCTATACCCAACAATGAAGCCTTATGAATATGGGTTTCGAGTGTTCTTGTTGACATATTGTTTCATCATGGTATCTGGGTATAGGACAAGGGAATTTGTCCATACGGCTGTGTCACGATTCTTGCTTATTGCACTGGGTGCTGGTGTTGGTTTGGGAGTAAATATATGCATTTTTCCCATCTGGGCTGGTGAGGATCTGCATAAATTGGTGGTAAAGAATTTCATGGGCGTCGCAAAGTCATTGGAAGGTTGATTTACGATATGCTTTGCTTTTGTTGGATATTGTAAAATATTTTTCTTTTATTAGTCCAAACCCCACTTTTGTCATAATTAATTTCCTTTATTGACTATCTTTATCATTTTTTAGGTTGTGTTAATGGTTACCTTAATTGTGTTGAATATGAGAGAGTTCCTTCTAAGATTCTTACCTACCAAGCTTCTGATGACCCGCTTTACAGCGGTTACAGATCTGCTGTGGAATCTACCAGCCAAGAGGACACTCTGGTATTCTTTGTTGTAACATGGTGATGCATTGGCAATTCACCATATTGGCAGAATTTTTCTTTCGGTTTTTGTTTTAACTCATTATTTTGTTTGAAGATGGGATTTGCTATCTGGGAGCCACCTCATGGTCGTTACAGAATGCTTAAATATCCATGGAAGAACTATGTAAAAGTAGGTGGTGCACTAAGGCATTGTGCATTTACGGTCATGGCATTGCATGGATGTGTACTTTCTGAAATACAGGTACTAAAAATTTCCACCTCTAACCACATTGTGAGGCAATTAATGACAAAGATACTGTATTTGTATTTTCATTTATTTGGGCTTTTGTATATACTTTGGTGTAGCATGACAATGATGATATGTAAGCCTCTGGAATTTTTTTTCCTTTTAAAAGTATTGCTCATTCCAAAAGTAGTTCCTTCCTTCTGATTTCCTATTCTAAAGGAAGAAATCGTGAATCAAAGGCCTTGCATGAACAAATGATTTTTGGTTATGGTTTCCCAAGTATGGGTGGTTATACTCTTCCATTTTTTCCTAGTGAGACCTCTGGAAAGAATATATGATAGCCGTGCTTGAGAGCATGTAATTTTTTTCCCTTATCTTCTGGACTTCAAAGATAAGTTGTGCACTTTGGGTATTTAATAGATTTGTTTGTTTCGTGAATATATCTCATGGTCTACCTTTGTTCTTTAATATGAATGACATGTAGTTACCATTATTTTAGTTTTTTTTTCTGGGCCCTGAGGAAGCTCATTCAGTAATGGCAGTCATGGCATATTCGCCATCAAATATAGCTTGGTTGCATTGTGTTCTTTTTCTTTAAGATTTTGTCAATCAGAATGTTTCTGTGTTGTCTGCTGGCCCATTGGCTATTCAATAGGTGTCATTGCCATCTTTGTCAAGTCGTCTTGTGCCATTGAATGCAGCTTTCACCTTCTCTCCTTCCAAGGCTCTAAGAGTTTTTGGCTGTAAAAGGGGTTTTTTTTGGGGGGTTTTGGGGTGGGGTGTGGTCGTGGTGAAAGAACATTGATATGCAAAGAGTTCACAAGACCAAGTTTTTGAGAAGAGGGTCTTTGATGTGGTTGTATTCCCTGTGGACTCAAAAATTGAAATTCTGATTTTGGCGGCTAATATCTACTGACCCTTGTGCATTTCGGGTATTCAAGTTCATATTCCACCTGTTTTGGAGAGATAAATGCTCTGCCCGGTCTCATCCTAACTGGAGCCAAATATGCAATATTGACATTTCATCAAAACTTTATCTTCCATACAATGAGACGTTGGCTGCACAAAATAAAAGTTTGACCTTCTCACTGAATTGATTAAAATGGGATGCTCAACTCTTTTGGTTATCTGGGCATCTTGAAGCGCATCAGATGAAAACATGAGGTCATTGTTTTGCCTGAGAGTTTAATATTTTCTCAATTATCATGCCTGGGAAAGTTCTTCCTGCCAAGTCATCTTTGGTGTTTTTGTCCTGAAGAACTCTCATTGAATGATGTATATGTGTGGGGGTATGAAGACTGTAGTTGTATGCAATTCAATATCTTATACTACAACCCTCCTGGTTCGCTAAGTATCAAAACCTGTGGTGGATGTTTATCTTGTTTTATGTACATGCAACTGTAATGGTCCTCGTGCATTTGATAAGAGTAATTGTAATTTTCCTGAACCATCTGTACGTATTTGTGTTTTTATTTGACATGTTATAATCTATTTTTATTTAACTTCCAACATTTGTGTATGTAGGCTCCTGCTGAACGAAGACAAGTATTTCGTAGGGAGCTCCAAAGAGTTGGTTTTGAAGGTGCTAAAGTGTTGCGTGAACTTGGGAACAAACTGAAAAAGATGGAGAAACTAGGTTCTGTAGATATACTCAACGAAGTGCATGAGGCTGCAGAGGAGTTACAAAAGAAAATTGACCAGAAGTCATACCTTCTTGTTAATTCAGAAAGCTGGGAGATTGGAAGTCGGCCAAAGGAGGTGGGAGATCCTCAAGACTTATTGAACTTGAATGATGACGAAAATACGTTCCGGGAATACAAATCCCTTAGTGAAGCTGTGCTTGATCTCAGATCTTTTCCTGTGCCACAAAGTTGGGATGGCCAAATGCCTGCGATGCCAACTGGCGTGAGCCCCATACCCACTGATGTCAACCGCTCCAACCCGCCCGTAGGTTTTTCCTCAGGAAGCATGTTCATGAAACAGGTTTCATGGCCTGCAGGACTGAAATTTGAGGTTAACGAACCTCCAGTAGCAGAAGAATCCAATACCTACGAAAATGCTAGTCAATTGTCGTTAGCCACATTTACATCCCTGTTGATAGAATTTGTTGCAAGGCTTCAAAATCTTGTCGACTCATTTGAAGAATTAAGTGAGAAAGCACGTTTCAAGGAACCTGTCGAATCACCAGAAGTATTAGAGCCACCTCGCAGGTTTTGGACCAGATTGCTCAACTGTCTGAAATCCTAA
On connectomes and cell lineages Jun 10, 2011, 6:59p - Science
(If I blog rarely and if my rare posts are only about my worms, then I must simply be obsessed with them. And that's just the way it goes I guess.) The organism, the biological being, is the most amazing object in all the world. I find it more intriguing than basic physics (which in its own right is pretty ... more »
Read comments (3) - Comment
Yu-li
- Jun 16, 2011, 10:23a
Hi, your post is quite interesting even though I do not fully understand it.
Here's my thought/question that just passed through my mind.
In case of Homo Sapiens(haha;;), "locked-in syndrom" happens. Even if one can no longer respond to being poked in the back or anywhere he/she still can have consciousness. (It would correspond to activities of other alive neurons though...) Motor neurons might not be an essential part of our consciousness.
So, I wonder if "locked-in syndrom" is possible for the worm. It might be hard to answer, but a necessary condition is signals in the neural network even when all the motor neurons are killed. (Life of the worm should be maintained during the experiment(?). I don't know whether it is possible.)
My thoughts are not very clear, because I do not know much about the language of neural network of the worm.
I just thought your ideas about the consciousness of worm was interesting, and I wish to read more on it. Thanks~
nikhil
- Jan 9, 2014, 6:35a
For those wondering how the data were collected: I manually analyzed the lineage diagrams from Sulston that I found in the back of Wood's C. elegans book. There was no digital resource for the lineage at the time, so I used a ruler to resolve events on the time axis down to 5 minutes.
Haoqi Chen
- May 15, 2015, 1:05a
Thank you for building this really fancy app. I'm currently analyzing the cell lineage and I wonder if your digital version of the C.elegan lineage can be adapted to statistical software like R? for example, be rewritten as a .phylo object in ape package?
A simple web-app for counting events over time Nov 16, 2010, 11:01a - Science
I've been trying to count the number of times my little worms (aka C. elegans) chew, so a couple weeks ago I wrote a web-app to help me quantify this a bit more accurately. They chew very fast (3-4 times per second), so I needed something that could keep track of that over time. I also needed something that ... more »
Read comments (3) - Comment
Gokul Rajan
- Nov 16, 2010, 7:49p
Nice work!!
Serena
- Feb 11, 2011, 10:51p
cool~ and,worms do phototaxis!
Lucas Jaffry Davis
- Aug 22, 2021, 11:46p
This space bar counter helps you to count the quantity of your times you will hit the spacebar throughout a given amount of time.
Generally, some games would like you to use the spacebar for some necessary actions like shooting or jumping etc. So, you higher be fast at that!
Spacebar speed take a glance at permits you to submit your score likewise as save your Personal Best scores for each interval. you will raise your friends to need the spacebar challenge and beat your score.
Video of real bacterial chemotaxis Jul 4, 2010, 7:02p - Science
(This is the 4th in a 3-part series on the biology of bacterial chemotaxis. Consider it a video bonus. Parts 1, 2, and 3 are also available.) I finally found a video of bacteria chemotaxing, and I wanted to share it with you (so I could finally shut up about bacteria by reaching some sort of closure on ... more »
No comments - Write 1st Comment
Here's hoping the bacteria don't crawl off the screen Apr 12, 2010, 5:13p - Science
(This is the third in a 3-part series on the biology of bacterial chemotaxis. The first post described some basic ideas about biological analysis, and the second post introduced bacteria and their chemotactic behavior. And don't forget the bonus video post.)
Alright, now that the context has been set, I can finally dive into my bacterial chemotaxis simulator, which ... more »
Read comments (2) - Comment
becca
- Apr 12, 2010, 7:06p
Yay! Es un simulador muy bueno.
Rolf
- Aug 25, 2010, 5:04a
Nice app! I've programmed a very simple optimization algorhitm in Matlab and SciLab based on bacteria behavior.
My bacteria takes a step of constant length in its direction. Then, it compares 'sugar concentration'. If lower, it tumbles, otherwise its orientation stays the same.
Interestingly, this procedure finds the minimum of the Rosenbrock function and other test functions.
Bacteria don't have to be icky Feb 7, 2010, 10:30a - Science
(This is the second in a 3-post series on biology. The first post gave background on the various levels at which biologists analyze organisms. This post discusses bacteria and an interesting behavior that they have called chemotaxis. The last post will present a web app that's an interactive simulator of this behavior. And don't forget the bonus video post. ... more »
Read comments (2) - Comment
Ruggero
- Feb 18, 2010, 1:21a
I suppose that tumble probability increases with sugar concentration, so the bacteria spend more time in the area they like most.
nikhil
- Apr 12, 2010, 5:44p
That's an interesting idea which I haven't tried, but the conventional wisdom is actually the opposite. Based on what I've read, it seems that real bacteria actually tumble less when they're moving up a sugar gradient, and tumble more when they're moving down a sugar gradient, though they do adapt and return to a baseline tumbling rate.
It would be interesting to try your idea in the simulator (which I just posted) and see what happens. Unfortunately, there's no easy way to do this in the interface provided, so you'd have to change the javascript to try it out.
A Note about Biology Dec 25, 2009, 3:11a - Science
(This is the first in a 3-post series on biology. I begin with some background, mostly to provide context for the second post, which is about a behavior in bacteria called chemotaxis. The third post will introduce a web app that simulates bacterial chemotaxis, and will be explained in gratuitous detail. I made it over a year ago, and ... more »
Read comments (4) - Comment
Ruggero
- Jan 4, 2010, 3:26p
Excellent post.
Biological systems are far more complex than any of the system we've been able to come up with so far.
So far.
There'll be a time when the products of our minds will be more complex and smarter than us all. And probably at that time it won't make much sense anymore to talk about 'products of our minds' and 'us' because they will merge one into the other. If you think more carefully, this actually already happened. Do you wear contact lenses? Do you have a tooth filled? Do you have a hip replacement? Do you know of Oscar Pistorius? Technology is rough, but it's slowly integrating with biology. And not only at the macroscopical level. The most interesting works are in nanotechnolgy, where the distinction between an engineer and a chemist (or a biologist) becomes pretty hard to make.
Biological systems of course are still much smarter than robots. This is partly because biology writes information on DNA (about 3 nm), where current technology only goes down to 32 nm. And partly because we don't know how to handle matter properly yet. What is DNA if not a self-assembly material?
'Cleaner' substrates? There's nothing really clean even in engineering, believe me. 'Simpler' would sound much better.
Is there a basic biological principle we are missing? I don't know. I only know that there's a lot more to know about the language used in nucleic acids. If the principle is there, it has to be written down somewhere.
A question: does a virus chemotax?
nikhil
- Jan 4, 2010, 8:00p
As far as I know, a virus doesn't have any ability to actively move through space. A bacterium, on the other hand, uses flagella as propellers to execute a biased random walk through space. So I guess that a single virus wouldn't be able to chemotax. I haven't really looked into it though, and perhaps the right experiment hasn't even been tried, so I could be wrong.
Sundar
- Jan 10, 2010, 5:44p
Nice post, I do find biology interesting when written this way. I hated it because I did not want any part of dissection and infact, refused to in high school.
PS - engineers do not always deconstruct human made devices, sometimes it is also nature like "Big bang" - unless you are differentiating between engineers and scientists
nikhil
- Jan 15, 2010, 12:44p
yep, i'm distinguishing engineers, who build things, from scientists, who try to understand how non-human-made things (nature, socieities, human minds) might work.
oh how vegetarian of you :)
Visualizing a Worm's Neural Network Apr 21, 2009, 11:17p - Science
For almost a year and a half, I've been working in Bob Horvitz' lab at MIT studying the nematode C. elegans. A microscopic worm of diminutive proportions (weighing in at only 1 millimeter in length), a single creature is just smaller than the size of an eyelash. These worms have been studied since the 1970s and much is known ... more »
Read comments (17) - Comment
Sundar
- Apr 22, 2009, 6:31p
Very cool, nice to see you doing great work. thanks for the chrome plug:)
Ruggero
- May 15, 2009, 12:46a
Simply fantastic.
Matej
- Sep 5, 2009, 4:33p
I'm involved in neural networks in computing (artificial NN in chips) and this is very interesting for me.. Nice!
Carlos
- Nov 30, 2009, 4:10a
Excellent iniciative!
Diablo
- Sep 5, 2010, 2:13p
Interesting.
Drew Barfield
- Oct 6, 2010, 2:12p
Awesome. A very useful tool.
Gokul Rajan
- Nov 16, 2010, 7:59p
This is simply fantastic! Now i know how your engineering skills are helping you here! :) great work!
Jason Toy
- Jan 30, 2012, 11:00p
great work
jaronimoe
- Jul 19, 2012, 12:35p
Hey nice work!
Did you by any chance publish an article about this tool of yours at a conference?
I would rather cite an article than a webpage ;)
nikhil
- Jul 21, 2012, 9:31p
Nope, no article yet. It's still a work in progress, and there are a few more features I want to add. I'll post a link here if I publish it in the old-school way.
What's wrong with citing a webpage?
jaronimoe
- Jul 24, 2012, 5:30a
There's nothing wrong with citing a webpage but my university prefers literature citations since articles are reviewed and webpages "grow in the wild" - e.g. anybody could state anything on a webpage.
But since I'm citing a visualization application and not some scientific statements it should be no problem.
Thanks again!
jaronimoe
- Jul 24, 2012, 5:36a
I forgot to ask:
what does the size of the arrow tip represent?
nikhil
- Jul 26, 2012, 8:26a
The size of the arrow is proportional to the number of chemical synapses between two neurons.
Likewise, the size of the orange bar is proportional to the number of gap junctions between the two neurons.
Often we assume that the more synapses that exist between a pair of neurons, the more likely the neurons are functionally connected. But this isn't necessarily the case, just a place to start thinking.
Harry C. Pedersen
- May 7, 2015, 5:09p
Good job! But why such a complicated organism? Why not some thing with only a single neuron? Yes, I know , it is not a "net", but, it does interact, with the environment, in some simple way. And it interacts, with the parent organism, in some way. Hopefully a simple to understand way. The knowledge thus gained, may just pave the way, to a little more complicated network, one, perhaps with 2 neurons. Thus, at last, we come to a neural nat work.But, with some use full knowledge. And maybe, if we are lucky, some sensible rules. This, is, of course, just a suggestion. I am not an expert, or any thing , but, may i suggest a possible starting point? The single celled organism, known as the "euglena
". these things operate as plants, when light is present, but act as animals, when light, is absent.How this happens, is not as simple, as it at first appears. Yes , the chlorophyl molecule, can act as a switch. But, what exactly gets switched? I asked this question , in high school biology class, and got booted out, as a "wise guy. But I guess my timing was off, as this was 1957, and I have to assume, that no one was quite ready to answer such questions, back then. At any rate, thanks for hearing me out. Harry
Nic
- Sep 9, 2021, 2:23a
Is this model now basically complete, in terms of the basic connectome?
nikhil
- Sep 9, 2021, 7:50a
The model is complete. However, as researchers generate and/or analyze new datasets, new and different connections are being found. See Cook..Emoons 2019. Whole-animal connectomes of both Caenorhabditis elegans sexes.
Available at https://www.nature.com/articles/s41586-019-1352-7
Doublestar Rock
- Jun 2, 2023, 10:42a
very interesting work!
A Reflection Sep 28, 2008, 3:23p - Science
"I sometimes ask myself, how did it come that I was the one to develop the Theory of Relativity? The reason, I think, is that a normal adult never stops to think abour problems of space and time. These are things which he has thought of as a child. But my intellectual development was retarded, as a result of which ... more »
Read comments (1) - Comment
omar
- Oct 11, 2008, 9:45a
so was he a genius? did he have 5 wisdom teeth?
Why Study the Brain Jun 1, 2007, 6:08p - Science
To apply to grad school, I had to write a personal statement that explained why I wanted to study neuroscience and why I would be successful at it. Here's the essay I wrote for my MIT application, way back in December '06. Reading it again, it seems a bit corny. But I guess these things always do. Especially when you're ... more »
Read comments (28) - Comment
Anonymous
- Jun 8, 2007, 4:59p
wow
Anonymous
- Jun 12, 2007, 10:59p
like the previous comment said really wow!
Anonymous
- Dec 15, 2007, 6:57a
I can't tell you how much of an impact the last para (especially the second sentence) had on me.
Gokul Rajan
- Nov 13, 2010, 9:05p
Ahh.. its really great to hear that someone can have interest in neurobiology from 11th grade!! When i was in school and used to say that i'm interested in neuroscience, people gave me a very strange look!!!! lol :D But I still took up life sciences...
Then why did you go for engineering??
nikhil
- Nov 15, 2010, 12:33a
i guess i had more passion and energy to learn how to build the things my mind kept imagining, dissatisfied with just letting them stall as ideas. funny thing is, even as i do science now, i'm constantly making minor improvements and writing new software to make the experiments easier, more reliable, and more efficient. so the engineering skills have really come in handy for doing science.
Gokul Rajan
- Nov 15, 2010, 7:05a
yeah.. indeed neuroscience is a lot dependent on technology! we need more advanced and innovative technology to solve the mysteries of the brain!!
Chigozie Hilary
- Aug 28, 2014, 12:36p
I must say, Nikhil, a big thank you because your story has really spurred my passion a great deal to continue in my pursuit of neuroscience study, to serve mankind... for I will write my name on the annals of history. Thank you.
Pankajam
- Sep 29, 2016, 10:20a
Very Inspiring!! Glad to be pursuing neuroscience and more glad to see that it means so much to others too!!
Mud
- Feb 5, 2017, 9:51a
So, is there an update on you now? What more have you created in the last 7 years? I could feel your passion through your words.
Loved it!
Mud
- Feb 5, 2017, 9:53a
I just realized your last response was from 7 years ago. Your submission was actually from 10 years ago. Wow. Give us an update!
nikhil
- Feb 14, 2017, 11:21a
Hi Mud,
So, here's the brief update of the last nearly 10 years.
(1) I spent several years at MIT in grad school trying to assess consciousness in the nematode C. elegans using a task that correlates with conscious awareness in humans, called trace conditioning (think Pavlov's dog). You can read more about this in my thesis (http://hdl.handle.net/1721.1/91702 , see chapters 2 and 3). Unfortunately, I was never able to get the worms to learn to do this task, so instead settled on studying how the worms sense light, despite the fact that they don't have eyes. I discovered that they actually "taste" light by sensing the hydrogen peroxide that light generates within them.
(2) Now, I am doing a postdoc at UCSF, still focused on trying to study the neural circuits of consciousness. This time, I am trying to study blindsight (http://en.wikipedia.org/wiki/Blindsight ) using mice. No one has ever demonstrated blindsight in a mouse (though they have in monkeys), and if I can demonstrate it I may be able to track down neural circuits in the brain that specifically create the conscious experience of vision.
Mayssa
- Jan 27, 2018, 3:55p
That's amazing to have such passion and to really go after your dream and actually succeed, keep going I'm sure you'll do great stuff dude ! I am wondering if you can answer my question: what exactly is a neuron message ? I mean what is it made of ? Is it electricity ? I asked my teacher but he said he doesn't know, I mean what's more frustrating than that!! Please answer me, thank you
nikhil
- Jan 27, 2018, 11:20p
Hi Mayssa,
Neurons seem to "message" or "communicate" with each other using both electricity and chemistry. Fast-moving signals within a neuron are mediated by changes in electrical ions, while less-fast-moving signals can depend on electricity or more general chemical signaling pathways (chemical reactions). Neurons signal to other neurons generally by releasing a neurotransmitter (a specific chemical, e.g. serotonin) which is detected by another neuron via a chemical reaction (e.g. binding of the neurotransmitter on a receptor). Neurons also signal to other neurons directly electrically, using what is called a "gap junction".
So, you are write that neurons message using electricity, but they also signal using more general chemistry.
Mayssa
- Jan 29, 2018, 11:04a
Thank you very much for responding so fast, you have been very informative for me lately and pushed to follow my dream which is studying neurology "to the fullest" and then do researches on the mysterious facts that I wouldn't find an answer to. You are such an insperation I'm glad I came across this web page :)
Mayssa
- Feb 1, 2018, 5:27a
I've got a few more question for you if you wouldn't mind, are there many types of glial cells or is it just one type ?
And are the structures of the white and grey substances the same in the brain and in the spinal cord ? Or are they different ?
nikhil
- Feb 1, 2018, 8:58a
Hi Mayssa,
There are many types of glial cells: astrocytes, oligodendrocytes, and others. Best to check Wikipedia: http://en.wikipedia.org/wiki/Neuroglia .
White matter in general are neural processes (e.g. axons), and grey matter is in general neuronal cell bodies, where the nucleus is located. Whether these are the same in the brain and the spinal cord I do not know for sure, but I would suspect as much.
Mayssa
- Feb 1, 2018, 3:04p
Thanks again for responding
I am a bachelor student and I am currently studying the neural system in biology class, I love it very much and my teacher doesn't usually find the answer to all my questions, he thinks that I think too much and that I shouldn't be asking all sorts of questions in class, he thinks that I should take things in a more simple way and just study them in the way they are, again with not too much questions asked . It really frustrates me a lot and I can't get the questions out of my head. I don't know what to do ? Can you please help me ? What do you think I should do ? Should I stop looking so far and just take it the way it is? Or should I keep on questioning and asking ?
nikhil
- Feb 1, 2018, 3:50p
Keep asking the questions, over and over again. The Internet is your friend, esp. starting with Wikipedia and going from there. If your teacher can't answer your questions, search for answers elsewhere.
Mayssa
- Feb 1, 2018, 11:47p
Thanks for the advice, I am sure now that the way I'm processing new information is NOT wrong and I shall always keep my questions coming until I find the accurate answer that I am looking for. Thanks a lot, what a relief to know that I am doing it the right way.
Mayssa
- Feb 19, 2018, 1:43p
Hi, I am back to you with another question if you wouldn't mind : how exactly does the biceps muscle relaxes (= extends) due to the arrival of the neural message( that is created due to the stimulation of the sensitive Ia fiber) I don't know if i got to explain what I mean because I am studying neurophysiology in frensh not english, so I do hope you would understand my point and answer me. thank you
Mayssa
- Feb 19, 2018, 1:50p
P.S: I have already tried googling it but I didn't get the answer I was looking for so basically you are the only source of information.
Please respond as soon as you can
Shehani
- May 8, 2018, 7:23a
Wow! Your accomplishments truly inspire me. Im a bachelor student in Canada majoring in Neuroscience, Im an international student so tuition and expenses are quite steep. I was wondering if you had any advice for students with a degree in Neuroscience fresh out of university. I still have a few years to go till I graduate, but post-undergrad job opportunities for students with a Neuro degree seem pretty slim. The only option appears to be graduate school. And for an international student affording graduate school immediately after undergrad isn't exactly possible. Do you know of any career options, in the same field, that a Bachelor of science in Neuroscience can get you. I simply adore studying neuroscience and desperately do not want to change my degree choice. But Im afraid I'll be stuck after I graduate, since doing a Masters degree immediately is not an option for me.
Anonymous
- Sep 23, 2018, 5:39p
This is actually amazing, and your ideas are brilliant.
Hema
- Nov 22, 2020, 10:01a
That's a really inspiring article!
k
- Dec 11, 2020, 11:44p
I came here looking for reference to use while writing my college application. By reading this I realized how much I don’t know about neuroscience. I’ve only recently felt so inspired and happy in pursing a specific field, but I’m a bit intimidated by it. I landed on neuroscience because of psychology. Now I ask the question, why neuroscience? I have a lot more options and time as a sophomore in high school. Is this the career in should pursue?
NeuroLover
- Feb 1, 2021, 8:46a
JUST WOW, truly loved ur essay!
Anonymous
- Apr 1, 2024, 6:47p
Amazing!
Harnoor Singh
- Jun 26, 2024, 2:46a
Thank you for the insights!
Water Crystals Jan 27, 2007, 1:17a - Science
Science is the most arrogant and the most humble of suitors. Endowed with the audacity to seek Truth yet the humility to prove only falsity, it seeks knowledge as its ultimate goal. Its right has been handcuffed by its left, and together the pair lurch through the world, disposing of the old and selecting of the new. The trail behind ... more »
Read comments (6) - Comment
omar
- Jan 27, 2007, 5:52p
those are quite beautiful! but the idea that the stimulus is the key independent variable influencing the look is just ridiculous, and you do a good job hitting all the major points.
nikhil i suggest you do a quick read in research experiment literature so you can get down with the terms and better organize what went wrong with the situations you're going to examine.
i feel like this is an exercise you'd give a class that's learning how to do "respectable" research. find everything that's wrong with this method. it seems you've hit on all the major things. i'll just mention two key evaluation criteria often used to evaluate experiments: internal and external validity.
internal validity means that an experiment strongly supports the conclusion that the independent variable (in this case, what the water is "shown") causes the variation in the dependent variable (namely, the patterns that are formed). you point out that they didn't control for other factors, they didn't do any reasonable statistical analysis to show that this is unlikely to be due to chance... there are a bunch of competing hypotheses to explain these patterns, none of which have to do with the specific stimuli.
external validity is usually concerned with possible generalizations and repeatability. of course, as you point out, this experiment has no external validity.
http://en.wikipedia.org/wiki/Internal_Validity
http://en.wikipedia.org/wiki/External_Validity
Justin
- Feb 10, 2007, 10:02a
Thanks for doing this research. This is disappointing and comforting at the same time.
me
- Jul 18, 2007, 1:53p
Thank you for your information. You saved me lots of money from buying that book though it has much advertising in many bookclubs and stores! You help lots of people who are Not scientifically inclined,and also to broaden their inquisitiveness and learning.
carmen
- Jul 28, 2007, 12:28a
I just read the book and was looking on line to find anything or anyone that could articulate for me what I felt when I finished reading his book. Yes they are beautiful pictures and it is a interesting idea but the science they used, or present, leaves one feeling betrayed. Thank you for your insight!
student
- Sep 10, 2007, 7:41p
i think ALLAH is true and you need to enter ISLAM.if you don't belive it you look the AL QURAN water crystals!!!!!!!!
ace
- Oct 5, 2007, 10:23a
yea i agree people
|