Annual car inspection (aka state-mandated consumption) Apr 17, 2012, 4:54p - Law
The way I like to think about taxes is that it's goverment-mandated homework. Just when you think you're done with school and you'll never have to do homework ever again, haha, think again. At least that's how it feels to me. If you're lucky enough to own a car and live in the only state I know that likes to ... more »
Read comments (6) - Comment
Sachin
- Apr 17, 2012, 5:26p
Wow, that's super lame.
How much is the inspection itself?
When are you moving??
Dan P
- Apr 17, 2012, 6:22p
Hey dude -- interesting post. Don't forget about our lovely Smog Check system out here in CA
Glad to hear you're heading back out to CA. Bay area or otherwise?
Marlon
- Apr 18, 2012, 8:41p
Great read, thanks for sharing the gory details. Sounds like Mass is a fascist communistwealth. Come back to California soon, we love cracked tail lights!
nikhil
- Apr 19, 2012, 10:53a
The inspection itself is set by the state at $29, and almost every gas station or mechanic is licensed to do it.
Moving to Bay Area, but not for 1-2 more years... Gotta keep the worms happy until then!
John
- Jun 19, 2012, 12:47p
Fascinating post. On a similar note: what if I don't want to not slap people in the face when best suits me? When will government do the right thing and give me my independence back?
nikhil
- Jun 20, 2012, 6:41a
Independence is never given. It must be taken.
Making DNA look simple (again) Apr 10, 2012, 6:30p - Science
I recently got sick of doing science. After observing my own productivity and passion for science ebb and flow over the past few years, I've found that I live a roughly 6-month cycle: 6 months of scientific experiments, 6 months of something else (usually programming, often blogging, sometimes installing hardware floors and doing experiments on myself). It seems that when ... more »
Read comments (55) - Comment
Tron
- Jul 25, 2009, 10:27p
Thank you very much for making this available.
belle
- Aug 5, 2009, 7:16a
this is the best thing since sliced bread!! thank you just saved me thousands of hrs
dude,
- Nov 3, 2009, 6:33p
awesome.
jasonII
- Nov 12, 2009, 8:59a
Thanks, this works great. A few things though. Some of us work on large (18kb) genes. Is there any way to change the scale bar? Also, being able to indicate alternative spice events would be nice.
nikhil
- Nov 18, 2009, 9:29p
Thanks for the request jasonll. I've updated the graphic maker so you can now change the size of the scale bar, to be something more appropriate for your 18kb genes. Not sure what the convention is for indicating alternative splice sites - why not just make 2 separate gene models? I guess if there are several it would be nice to consolidate them into one image. If you have any ideas about what this would look like, lemme know.
nikhil
- Nov 19, 2009, 11:54p
Alan Marnett over at Benchfly.com asked me to write a blog post for them about the Exon-Intron Graphic Maker. It's just like this post, slightly revised. Storing the link here for safekeeping.
http://www.benchfly.com/blog/making-dna-look-simple/
omar
- Nov 29, 2009, 11:07p
dude this has advanced my research significantly
jasonII
- Feb 21, 2010, 8:40a
thanks for the scale bar modification. about the alternative splicing, i suppose it would be helpful if you could color them in. this would also be helpful to mark out certain functional domains easily. three or four colors would be wonderful and spice things up a bit!
siavash
- Apr 4, 2010, 6:10p
hi nikhil,
i also wanted to thank you for making this available. saved me so much time. also wanted to second jasonII's comment about other colors, for marking protein domains, etc.
but its wonderful, thanks a million.
Nick
- Nov 15, 2010, 7:09a
Thank you very much for this. I am an undergraduate doing a genetics research project and this has given me the ability to graphically show exon and intron positions the way I wanted to!
Pascal
- Feb 27, 2012, 7:34a
Great tool. What you also might want to consider is that UTRs can be across more than one exon. I think with the current options it is not possible to do that.
nikhil
- Mar 10, 2012, 7:36a
Pascal, actually I think you can do what you want.
Just like with the protein-coding field, separate exons and introns in the UTR fields with commas, and you'll be all set. That way you can display a single UTR containing multiple exons and introns.
jsto
- May 18, 2012, 1:24a
Thanks a mil nikhil
I wonder if its possible to extend the image to show up and downstream regions?
Pakpour
- May 31, 2012, 12:40p
Thank you thank you thank you so much for sharing this program. You have saved me huge amounts of time and it is such an easy and intuitive program to use!
BMD
- Dec 27, 2012, 12:29a
Hi Nikhil,
Thank you for this awesome tool! I used it to make a figure for my PhD thesis. I couldn't find any other tool that would draw high-res gene structures for me. At first, I was skeptical, because your tool required manual input of the sequences and boundaries, when this information is already available for my genes in GenBank. Also I was worried that the spaces and numbers that were contained in the sequences I pasted would mess things up. But it worked fine and only took a few minutes to copy-paste the sequences and put the commas. The genes I'm working with are monster genes with tons of exons each, and some very long introns, so I'm glad it worked so well. The only thing I would have liked is to have an option to have the exons numbered.
Jason
- Nov 2, 2013, 11:03a
That is art!
Steve
- Oct 15, 2014, 6:53p
very cool! i'm using it to make group meeting slides, and am finding that the text is coming out a bit small. any way you could add a feature to let you change the font size?
nikhil
- Oct 20, 2014, 8:10p
Hi Steve,
To make changes to the text or anything else in the graphic, download the PDF and open it in your favorite graphics program. I use the open source alternative to Adobe Illustator called Inkscape. There you can make any changes to your heart's delight.
Kuldeep
- Jan 14, 2015, 7:44a
How to add the size of exons (bp) or introns (bp) in the map? For comparison of same gene of different organism, is it possible to go in single run?
Although it is very helpful I would like you thanks a lot.
nikhil
- Jan 14, 2015, 8:02a
Hi Kuldeep,
There is currently no way to automatically annotate each exon or intron with its length in base pairs. I have never seen this kind of annotation before. Can you point me to an example of what this would look like?
Also, there is no easy way to compare multiple genes (e.g. across organisms, across isoforms) at the same time, yet. This feature has been requested several times so I may add it in the future.
Lisa
- Jan 15, 2015, 7:14p
For some reason, the scale bar isn't changing for me whatever number I put from (1-1000bp). Is there anyone else facing similar problem or is it me only??
nikhil
- Jan 15, 2015, 9:25p
Hi Lisa,
What browser, browser version, and OS are you using? Are you referring to the graphic made in the web browser, or the downloadable PDF? I just tested the graphic generated in the web browser on Firefox, Chrome and Internet Explorer on Windows 7 and the scale bar resizes just fine. How many bases have you entered? You have to enter some bases before the scale bar will be displayed.
Lisa
- Jan 18, 2015, 1:51a
Hi Nikhil,
Thanks for your reply. I misinterpreted the use of the scale bar. Is there any means to increase the width of the exons ? (and the introns could probably be joined by dots which are not to scale) I am working on human genes and there are a good number of mutations to show in a single exon itself. The width of the exons doesn't permit me to be able to show all the mutations.
Thanks again
nikhil
- Jan 18, 2015, 8:43a
Hi Lisa,
There is no method for increasing the width of the exons. The main function of this app is to quickly make exon-intron graphics that are to scale. I'll keep your issue in mind, but for now I suggest using the Exon-Intron Graphic Maker to make the gene model to scale, and then downloading the PDF to alter the scale in a free app like Inkscape. You could also mark all the mutations in the Graphic Maker, even if they overlap and are too dense, and then spread them out in the PDF so that relative position within the exon remains to scale.
YZ
- Nov 10, 2016, 6:19p
I really enjoy the program. Please excuse my otherwise probably simplistic question. When creating a gene diagram, there are some exons that could be small at only few dozen bps. Some introns, on the other hand, could be thousands of bp. If done this way, when looking at the final graphic the exons are tiny because they are drawn to scale in proportion to the intron size. Is there a good way to account for that or would you suggest a different way to graphic it? thanks!
nikhil
- Jan 25, 2017, 10:42a
YZ, I would suggest a different approach in your case. Seems like you want a graphic that has different scales for the exons vs. the introns. My webapp doesn't support that right now, I'm afraid. I'm not aware of any way to do that except by hand in a graphics program.
Ankita Gurao
- Aug 21, 2017, 12:04a
The tool is very elegant and handy.Brilliant solution for presenting gene structures in publications. I have a suggestion for you, add a 'How to cite?' section.
Claud
- Sep 28, 2017, 6:50a
Thank you for the program. It have been very useful for me.
Could it be possible to add a section upstream and a section downstream of the beginning and end of transcription (respectively)? It would be very useful to add markers in those sections. Thanks!
nikhil
- Oct 5, 2017, 10:41a
Hi Claud,
Yeah, there isn't any easy way to depict non-transcribed regions using this web app. I'll consider adding something like this in the future. Glad you find this useful.
nikhil
- Oct 5, 2017, 10:43a
Ankita,
If you want to cite this web-app, you can use the following citation:
Bhatla, Nikhil. 2012. Exon-Intron Graphic Maker. Available at http://wormweb.org/exonintron
Claudia
- Aug 28, 2018, 6:31a
Good morning, first of all thank you for the useful program.
Is there any chance to change the color of the black bar representing the DNA sequence and to reduce it a little bit (or to increase the written label's size)?
I know it is a futile quesiton but it will improve the appeal of my immage.
Thank you very much.
Sean
- Mar 26, 2019, 12:36p
Here it is, 2019 and 10 years after you made this, and I only just discovered this tool. I just wanted to say thanks for sharing, it is very much appreciated!
Guangzhao Qi
- Oct 13, 2019, 2:26a
Thanks a lot!
nikhil
- Feb 4, 2020, 9:39a
Claudia,
For color and size changes, the best thing to do is to open the PDF in a illustration program, such as the free Inkscape. There you will be able to edit everything to your heart's delight.
Abdellah Barakate
- Feb 12, 2020, 3:10a
I love this Exon-Intron Graphic Maker but I am stuck with an issue. I have genes with introns in the 5'UTR and/or 3'UTR. Does anybody know how to add these introns?
Many thanks.
Abdellah Barakate
- Feb 12, 2020, 3:22a
Sorry guys, I just realised that I can add introns to UTR by simple using upper and lower cases as in the CDS.
Cheers
Sara
- Apr 9, 2020, 4:51p
Thank you very much for the nice tool!
Basharat
- Aug 13, 2020, 10:25a
Hi,
Can we use it for mapping point mutations in exon of mammles
nikhil
- Aug 27, 2020, 9:20a
Hi Basharat,
Yes, this program works with a genetic sequence from any organism.
Liina
- Oct 27, 2020, 8:16p
Thanks for this useful tool! I managed to retrieve PDFs for all of my genes, except TTN, which gave me an error 'The requested URL's length exceeds the capacity limit for this server' (PNG downloads ok). I blame the size of the gene (281 kb). Is there a workaround to retrieve the PDF that I could work with in the Illustrator?
Hart
- Dec 21, 2020, 6:15p
Useful tool!
Thank you very much
Vanessa
- Feb 21, 2021, 7:38a
Thank you so much for this useful tool! Is there any way to present genes in the negative strand? i.e. so that the pointer points to the left instead of pointing to the right.
David
- Mar 17, 2021, 7:59a
Fantastic tool! Thank-you for making this :)
SKT
- Jun 2, 2021, 4:27p
Hi, Is it possible to avoid having to manually enter the gene sequence? I have a long 20Kb gene.
GyuHwang
- Nov 23, 2021, 12:03a
Thank you. It's very useful tool.
When I just know intron length, so I use a exel function [=rept("a",intron length)] result. It is working well. :)
Erik Huckvale
- Mar 1, 2022, 12:33p
What tool do you use under the hood for the visualizations? Is it an R package or something with javascript?
Robert Mukiibi
- Oct 9, 2022, 7:34a
How about making it possible to color introns and exons different colors than just black.
Tamir P
- May 29, 2023, 5:16a
what a grate tool!
but- having problem with exporting as HQ PDF (500 Internal Server Error)
Linx
- Jun 15, 2023, 8:09a
Why cannot download the PDF from this website anymore?
Yanyan
- Jun 29, 2023, 7:20a
hihi,thank you so much for coming up with such a simple handy tool.It is a big big help, but unfortunately ?I can't download the PDF,I don't know if you could receive my message, if so, that would be great!
T
- Aug 4, 2023, 12:42p
Thank you so much for making this tool! I've been using (and citing) it for years. However, I just went to use it today and received an "Internal Server Error" message after clicking the "Download High-Quality PDF" button. Could you please help?
nikhil
- Dec 10, 2023, 12:04a
PDF download error should be fixed now. Sorry for the trouble!
Ish
- Aug 7, 2025, 10:46a
Is there any way to get gene and allele names in Italics?
Thank you.
HYY
- Sep 19, 2025, 2:43a
Thank you very much! It helps me a lot!
Anonymous
- Jul 16, 2026, 1:39a
GACTTGCCTTACCATTAAAAAGCAAGGGGAGCACAAGCATTATTACACAAAGCAAAAGCACTAGCCATGGCAGCGTCGCGCTACGAGGTGGAGGTGACGGTGGCCTCGGCGCGCGACCTCAAGAACGTCAACTGGCGCAACGGCGACCTCAAGCCCTACGCCGTCGTGTGGATCGACGACGGCGCCAAGTGCTCCACCCGCGTCGACCTCGACAACGCCGACAACCCCACCTGGGATGACAAGCTCACCGTCCCTCTCCCGCCCTCCACCCGCCTCGACGACGCCGTCCTCTACCTCGACGTCGTCCACGCCAACGCCACCGACGGCGTCAAGCCCCTCGTCGGCTCCGCGCGCCTCCCGCTCCGCGACGTCCTCGCCGACACCGGCATAGGCGCCCGAGCCTCCCGCTCCCTCCGCCTCAAGCGCCCCTCCGGCCGCCCCCATGGACGCCTCGAAGTCCGCGTCGCCGTCCGCGAGCCCAAGCGCTACTACGACCCCTCGCCGGCGTACCCTGCTCCCTACCACCAGCAGTCGTCCCGTGACCCCTACGCCTACGGTAACACTACAACTGGTGGCTATGGCTATGCCTATGGCGGGGCCCCTCCGGCTCCGTACTCCGCGGCCCCTCCTGCTGGATACCCGTCGGCCTATGGAGGAGCGGCTCCTACTCAACCTGCCTATGGCTCCGCCGCGCCACCTCAACCTGCCGCTGTCAGCTATGGAGCGCCTCCTGTGGATGCAAAGAAGAAGAGCAAGATGGGCATGGGGGGTGGGCTGGCGGTTGGCGCGGCGGCCGGCGTTCTTGGCGGTCTGGCGCTGGCGGGCGGCGCCAGCTACCTGGAGAACAAGTTTGAGGATCGCGTGGCGGAGCGGGTGGAGGAGGACCGCTACGGCGGCGGCGGTGGTGGCTACGACGACTACGGCGATGACGACTATTAATAATTTATATGATATTCGAATTGCACTTGCAGGGGAGTCAGATTATTGTAATTGAGTCTTGTGTTTTTATCATCCTTGTCTTACAAATCAATATCAAATTAAATTAAAACTCGTGTGTGTGTGTGTGTGTGATCCTAGCTAGCTGGGAGTATATCTCGATCCGTAGAGTTCCGGCGTCGACGGTGGCAGCGCCCACTGGTTGGCGTCGATGTAGGAGACGTCCATGAAGGGCGCGGCCTGGCGCTGGTCAAGCTGCCGCGCGTAGGACACCCTGCCGGTGGCGGCGGTGGCGGATCCGGGGCCCCAGCACGCGTACTCCGCGAACCACACCTGCTGCCGCCTGCCGGGGTCGCCCCAGTCGTTCCACCCCTCCGCCGCCACCACGTCGCCGAGGTACGTCTCCGCGAACACCACCGTCGCGTACGGCCCCCACGCCCTCCCCAGCCACACCTGCCCCGTCCCCACCACGCTGCACCGCACGAACGCGAACCCCGTCCTCTC
|